Ecific shRNA: RIG-I-1, ntGTGGAATGCCTTCTCAGAT; RIG-I-2, nt GCTTCTCTTGATGCGTCAGTGATAGCAAC; RIG-I-3, nt GATAGAGGAATGCCATTACACTGTGCTTG. Of
Ecific shRNA: RIG-I-1, ntGTGGAATGCCTTCTCAGAT; RIG-I-2, nt GCTTCTCTTGATGCGTCAGTGATAGCAAC; RIG-I-3, nt GATAGAGGAATGCCATTACACTGTGCTTG. Of them, shRNA RIG-I-3 silenced cells had been applied for function experiments. Similarly, 3 human AIM2 coding sequences were selected for building of distinct shRNA: AIM2-1, nt GCCTGAACAGAAACAGATG; AIM2-2, nt ATACAAGGAGATACTCTTGCTAACAGGCC; AIM2-3 nt CCCGAAGATCAACACGCTTCA. In this case, shRNA AIM2-1 silenced cells have been applied for function experiments. shRNA vectors IKK-β Species against human NLRP3, caspase-1, ASC, and their scramble vectors are gifts from Dr. Jurg Tschopp [34]. Briefly, THP-1 cells stably expressing shRNA have been obtained as follows: ntGATGCGGAAGCTCTTCAGTTTCA from the human ASC coding sequence, ntCAGGTACTATCTGTTCT with the human NLRP3 coding sequence, ntGTGAAGAGATCCTTCTGTA of the 39UTR of your human caspase-1 have been inserted into pSUPER. The Pol III promoter shRNA cassettes from these vectors and from a lamin A/C-specific pSUPER manage construct were inserted into the lentiviral vector pAB286.1, a derivative of pHR that contains a SV40-puromycin acetyl transferase cassette for antibiotic selection. Second-generation packaging plasmids pMD2-VSVG and pCMV-R8.91 [35] had been applied for lentivirus production.HCVcc Preparation, Purification and HCV RNA GenerationThe techniques of HCVcc preparation had been described [31]. Harvested HCVcc was purified by sucrose density gradient centrifugation and titrated [31]. To create the full-length genomic RNA, the 107 bp, 2406256 bp, 5626437 bp and 39UTR with the HCV JFH-1 strain [32] along with the pJFH-1 plasmids containing T7 promoter have been linearized at the 39 from the HCV cDNA by XbaI digestion [33], which was applied because the template for in vitro transcription (Ambion, Austin, TX, USA).Quantification of IL-1b Secretion by ELISASupernatants have been analyzed for cytokine IL-1b secretion by ELISA (BD Biosciences, San Diego, CA) according to the manufacturer’s instructions.Quantitative Real-time PCRRNA from human monocytes or Huh7 cells had been extracted applying RNA Lyzol reagent (EXcell Bio, China). cDNA was synthesized using the Rever TraAceHqPCR RT Kit (TOYOBO.CO, TLD, Japan). Quantitative real-time PCR was performed on a 7900 Rapidly Real-Time PCR System (AB Applied Biosystems, USA) applying SYBRH Green Realtime PCR Master Mix (TOYOBO.CO, TLD, Japan). The specificity of amplification wasPLOS A single | plosone.orgImmunoblottingFor immunoblotting, cells were lysed with buffer (10 mM Tris pH 7.5, 1 NP-40, 150 mM NaCl, and protease inhibitorHCV RNA Activates the NLRP3 Inflammasomecocktail). Proteins had been separated on sodium dodecyl sulphatepolyacrylamide gels after which transferred onto polyvinylidene difluoride membranes. The membranes were blocked with 5 milk in 1 X TBS with 0.5 Tween-20 then probed with primary antibodies as follows: rabbit anti-human mature (17 kDa) IL-1b (D116, Cell Signaling, USA), goat anti-human pro-IL-1b (31 kDa) (sc-1250, Santa Cruz, USA), rabbit anti-human caspase1 (sc-515, Santa Cruz, USA), and monoclonal mouse anti-human b-actin (KM9001, Tianjin Sungene Biotech, China). Appropriate HRP-conjugated secondary antibodies had been employed and signals had been detected making use of ECL reagent (Amersham, USA).HCV RNA Induces IL-1b Secretion in H2 Receptor custom synthesis MacrophagesAlthough we located that HCV virions did not activate the inflammasome in hepatoma cell lines or myeloid cells, we think that some elements rather in the HCV virion particle itself could activate the inflammasome, mainly because a number of reports showed h.